[Crac-bugs] CIGAR problem in CRAC

Mikaël Salson mikael.salson at lifl.fr
Lun 13 Mai 09:00:13 CEST 2013


Dear Linlin,

A new version of CRAC is available. You can download it from here:
https://gforge.inria.fr/frs/?group_id=3008&release_id=8050

It addresses your issue and also implements the proposition you made 
(having gzipped output, you should use --gz option).

Sorry for the delay and thanks a lot for your input!
Mikael

On 24/04/2013 00:07, Linlin Yan (颜林林) wrote:
> Hi Mikael,
>
> Thank you very much! It is very kind of you.
>
> The option "--all" will output multiple files, among which the .normal
> and .almostNormal files are usually big enough for compressing to save
> disk space.
>
> I am trying CRAC on some RNAseq data to find some de novo splicing
> site and gene fusion events.
>
> Linlin
>
> On Tue, Apr 23, 2013 at 4:02 PM, Mikaël Salson <mikael.salson at lifl.fr> wrote:
>> Dear Linlin,
>>
>> Thanks a lot for your report.
>> We identified the origin of the problem, and we will keep you informed
>> as soon as we have a solution.
>>
>>
>>> BTW, could you consider to export results in compressed format (.bam
>>>   and .gz)?
>>
>> Thanks for the idea. We will see if we can implement that. I guess .gz
>> output would be easier to implement (but maybe less convenient than bam).
>>
>>
>>> Thank you for the excellent work! I really like the tool CRAC!
>> Thank you! Just out of curiosity, for what purpose are you using CRAC?
>>
>> Best regards,
>> Mikael
>>
>>
>> On 21/04/2013 06:08, Linlin Yan (颜林林) wrote:
>>>
>>> Hi,
>>>
>>> Even when I tried the latest CRAC (v1.2.4), the problem still exists
>>> when I was trying to convert output.sam into BAM format. It
>>> reported:
>>>
>>> [samopen] SAM header is present: 84 sequences. Line 10376251,
>>> sequence length 98 vs 268435554 from CIGAR Parse error at line
>>> 10376251: CIGAR and sequence length are inconsistent
>>>
>>> My command line is: crac -i /rd/user/yanll/data/crac/human_g1k_v37 -k
>>> 22 -m 98 --nb-threads=4 -r ./00_data/H9_RNAseq_1.fq --sam
>>> ./40_map_by_crac/H9.crac_v1_2_4.sam --all
>>> ./40_map_by_crac/H9.crac_v1_2_4 ./00_data/H9_RNAseq_2.fq
>>>
>>> The bad result SAM line is:
>>> HWI-ST483:306:C143CACXX:3:1106:18488:94443      129     12 20727519
>>> 254     51S4294967295M26I22M    X       8789140 0
>>>
>>> ACCATCACTATCATCACAATCACCACCACCATCATCGGCACCGTCATTATCATTATCATCACCATCACCACCACAACATTATCATCACCATCACCATC
>>
>> FFFHHHHHGGHHHHIJJJIJJJJJIHHGIIIJJJJHIJJJJHIIIIIFIJJGIIJJIHJIFHFEHFFFFCDDDDDDDCACCEDCDDCDCCDDCDD9
>>>
>>>
>>>
>> XU:i:1  XD:i:1  XM:i:0  XN:i:0  XO:Z:11|-1,69871609     XQ:i:12
>>>
>>> XC:i:2       XE:Z:0:0:BioUndetermined:50:[ambiguous case : no start
>>> break]   XE:Z:1:1:Error:Ins:75:0.0744867:26:<snip>
>>>
>>> BTW, could you consider to export results in compressed format (.bam
>>>   and .gz)?
>>>
>>> Thank you for the excellent work! I really like the tool CRAC!
>>>
>>> Best wishes!
>>>
>>> Linlin
>>>
>>> _______________________________________________ Crac-bugs mailing
>>> list Crac-bugs at lists.gforge.inria.fr
>>> http://lists.gforge.inria.fr/cgi-bin/mailman/listinfo/crac-bugs
>>>
>>
>



More information about the Crac-bugs mailing list